Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0018289 | |||
Gene | SYT15 | Organism | Human |
Genome Locus | chr10:46968580-46969453:- | Build | hg19 |
Disease | Cervical Cancer | ICD-10 | Malignant neoplasm of cervix uteri (C53) |
DBLink | Link to database | PMID | 29156822 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 35 pairs of cervical cancer tissue compared with adjacent normal tissue and cell lines |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TCACCAACCTTTGCCCTTCACACCT ReverseAAGACTTACGTCTGTGTGCGTTGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Gao, YL, Zhang, MY, Xu, B, Han, LJ, Lan, SF, Chen, J, Dong, YJ, Cao, LL (2017). Circular RNA expression profiles reveal that hsa_circ_0018289 is up-regulated in cervical cancer and promotes the tumorigenesis. Oncotarget, 8, 49:86625-86633. |