circad | circRNAs associated with diseases

hsa_circ_0018289
Gene	SYT15	Organism	Human
Genome Locus	chr10:46968580-46969453:-	Build	hg19
Disease	Cervical Cancer	ICD-10	Malignant neoplasm of cervix uteri (C53)
DBLink	Link to database	PMID	29156822
Experimental Method
Sample Type	Tissues	Comparison	35 pairs of cervical cancer tissue compared with adjacent normal tissue and cell lines
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCACCAACCTTTGCCCTTCACACCT Reverse AAGACTTACGTCTGTGTGCGTTGT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Gao, YL, Zhang, MY, Xu, B, Han, LJ, Lan, SF, Chen, J, Dong, YJ, Cao, LL (2017). Circular RNA expression profiles reveal that hsa_circ_0018289 is up-regulated in cervical cancer and promotes the tumorigenesis. Oncotarget, 8, 49:86625-86633.